| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MOLECULAR AND GENOMIC |
1 Department of Neuroscience, Brown University, Providence, RI 02912, USA
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 9 June 2006;
accepted after revision 14 July 2006;
first published online 20 July 2006)
Corresponding author D. Lipscombe: Department of Neuroscience, Box 1953, Brown University, Providence, RI 02912, USA. Email: diane_lipscombe{at}brown.edu
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Recently, we reported that sensory neurons express a functionally distinct N-type calcium channel isoform not identified previously (Bell et al. 2004). This isoform, CaV2.2e[37a], contains a unique sequence in its C-terminus that originates from cell-specific inclusion of e37a, which is one of a pair of mutually exclusive exons, e37a and e37b (Fig. 1A–C). Our analyses showed that all neurons express CaV2.2e[37b] but that a subset of nociceptive neurons also express CaV2.2e[37a]. Using RT-PCR, we found little or no amplification of CaV2.2e[37a] in other parts of the nervous system (Bell et al. 2004).
|
In this report, we analyse whole-cell, single-channel and gating currents in mammalian tsA201 cells expressing either isoform to determine which differences between Ca2.2e[37a] and CaV2.2e[37b] channels regulate current density. Our previous analyses showed that CaV2.2e[37a] currents are significantly larger and that they also activate at voltages slightly more hyperpolarized than CaV2.2e[37b] currents when expressed in Xenopus oocytes. These data pointed to differences in gating as well as overall channel density between isoforms (Bell et al. 2004). We now show that CaV2.2e[37a] channels remain open for longer on average, and that the density of functional channels is significantly higher, as compared to CaV2.2e[37b] channels. We also show that these functional differences between isoforms significantly affect calcium entry evoked by action potentials recorded from nociceptors. Alternative splicing events under such cell-specific control probably evolved to contribute functional advantage to the cells in which they occur (Lipscombe, 2005). Our analyses of e37a/e37b splicing uncover new cellular mechanisms that regulate CaV2.2 channel activity in nociceptors.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
All clones used in this study were constructed in our laboratory: CaV2.2e[37a] (AY211500) (Bell et al. 2004), CaV2.2e[37b] (AF055477) (Lin et al. 1997), CaVß3 (sequence identical to M88751) and CaV
2
1 (AF286488) (Lin et al. 2004). CaV2.2e[37a] and CaV2.2e[37b] contain exons 37a and 37b, respectively, and encode proteins that differ by only 14 amino acids (Fig. 1A–C). We utilized Lipofectamine 2000 (Invitrogen) to transfect tsA201 cells (large T-antigen transformed HEK 293 cells) with a DNA mixture containing CaV2.2, CaVß3 and CaV21 in a 1: 1: 1 molar ratio together with 10% enhanced green fluorescent protein (w/w). tsA201 cells were maintained at 37°C with 5% CO2 in 90% Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% fetal bovine serum (FBS). We carefully minimized variation in expression by selecting cells at 70% confluence for transfection, controlling cDNA concentrations, and harvesting all cells on the day of recording (24 h after transfection) and maintaining them in DMEM at 4°C until needed.
RNase protection assay and analysis
We utilized the RPA III protocol (Ambion) and the Bright Star Biodetect procedure (Ambion) essentially as described in the product manuals. The e37a probe was generated by RT-PCR from dorsal root ganglia (DRG) mRNA and cloned into vector pCRII (Invitrogen) for in vitro transcription using the Maxiscript kit (Ambion). PCR primers were: r1B37aup, 5'TTGCCGGATTCATTATAAGGATATGT; and r1B41dw, 5'TTGTCGAAGGAAAACCCGAGCT. Following RNase digestion, the probe generated fully protected and partially protected bands of 520 bp and 429 bp, respectively. Control hybridizations using increasing amounts of template RNA ensured all probes were present in excess with respect to target mRNAs in DRG and brain. To resolve fully protected e37a signal, 7 µg total RNA was required. We measured e37a RNA as a percentage of total CaV2.2 RNA. First, a series of timed exposures to Hyperfilm (Amersham) were collected. Next, films were scanned as 8-bit, minimum 96-dpi, TIFF images, and band volumes quantified with ImageQuant software (Amersham). Background was determined for each lane: the volume of a box located above the signal of interest was subtracted from the volume of an identical sized box around the signal of interest. We extrapolated partially protected probe volume at the same time point used to measure fully protected probe volume.
Whole-cell recording and analysis
Whole-cell, voltage-clamp recordings were performed using an Axopatch 200A amplifier and pCLAMP 8 software (Molecular Devices). All whole-cell recording protocols were carried out in identical ionic conditions. The internal solution contained (mM): CsCl 126, MgCl2 4, MgATP 4, Hepes 10, EDTA 1 and EGTA 10; pH was adjusted to 7.2 with CsOH. The bath solution contained (mM): choline chloride 135, MgCl2 4, Hepes 10 and CaCl2 1; pH was adjusted to 7.2 with CsOH. Fire polished electrodes had resistances of 2–3 M
when filled with internal solution. Low extracellular calcium was used to minimize current amplitude and thus optimize voltage control (see also Thaler et al. 2004). We also found no correlation between current amplitude and mid-point values of activation curves (V
) values of activation curves, indicating adequate voltage control. Electrodes were Sylgard-coated (Dow Corning). Series resistances were less than 6 M and compensated 70–80%, with 10 µs lag time. Cells were held at –100 mV and stepped to various test potentials with currents sampled at 20 kHz. Tail currents were measured at –60 mV and sampled at 100 kHz. Gating currents were resolved by stepping the membrane potential to the ionic reversal potential, which was determined for each cell at the start of recording (Lin et al. 2004). All whole-cell data were low-pass filtered on-line at 10 kHz and leak subtracted online.
Action potential waveforms
Dr Bruce P. Bean, Nathaniel Blair, Jorg Mitterdorfer, and Michelino Puoplo kindly provided all action potential recordings used as command voltages. Four command voltages used in Fig. 9 were recorded from four different small diameter, nociceptive neurons of DRG (Blair & Bean, 2003). These action potentials have prominent plateaux characteristic of nociceptors. We used three single action potentials recorded from three different neurons with slightly different resting membrane potentials (Fig. 9A–C) and a train of action potentials (Fig. 9D) induced by exposure to 500 nM capsaicin (same voltage trace shown in Figure 1 of Blair & Bean, 2003). In addition, two representative action potential recordings were obtained from central neurons (Fig. 10A–B): spontaneous action potentials recorded from a dopaminergic neuron of the substantia nigra, and an action potential from a CA1 hippocampal neuron induced by a brief current pulse.
|
|
Cell-attached, patch-clamp recordings were performed at room temperature (approximately 21°C) using an Axopatch 200A amplifier and pCLAMP 8 software. The pipette solution contained 110 mM BaCl2 and 10 mM Hepes; pH was adjusted to 7.4. The bath contained (mM): potassium aspartate 140, glucose 10, Hepes 5 and EGTA 10; pH was adjusted to 7.4. Electrodes had resistances of 6–12 M when filled with pipette solution and were Sylgard-coated. Currents were sampled at 10 kHz and low-pass filtered on-line at 2 kHz. Leak subtraction was performed off-line using averaged null sweeps (30%–50% of all sweeps) taken at the same voltage. We used pCLAMP 9 software to classify and analyse single-channel events. To calculate single-channel conductance, we manually measured single-channel current amplitudes from 3 to 10 openings of durations sufficiently long to reach full amplitude (at least 0.6 µs). To calculate open dwell times we used a 50% threshold crossing to detect open and closed transitions. Events longer than 0.2 µs were included in the analysis. We set this as our minimum time resolution based on the signal to noise ratio. We set the ratio of the threshold crossing amplitude to the background root mean square noise at > 5 to reduce the probability of false event detection (Colquhoun & Sigworth, 1983). The maximum likelihood method was used to fit one or the sum of multiple exponential functions. Although our primary interest was in comparing single-channel current amplitudes and channel mean open times of the CaV2.2e[37a] and CaV2.2e[37b] splice isoforms, we nonetheless restricted our kinetic analyses to patches without (or with a very low percentage of) simultaneous overlapping openings and only analysed sweeps that completely lacked simultaneous openings. These criteria eliminated from kinetic analysis < 10% of the total number of sweeps in any given patch. This was important to avoid underestimating the mean open time as simultaneous openings are more likely to occur during longer open times. All patches included in our analyses contained between 3 500 and 12 000 openings.
Statistical treatment of data
All data are expressed as mean ± S.E.M. Student's paired t tests were used to determine statistical significance at the P < 0.05 level.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We previously showed (Bell et al. 2004) that DRG express CaV2.2e[37a] mRNAs. Based on these analyses, we found little evidence for expression of this isoform in other parts of the nervous system (Bell et al. 2004). However, our experiments used non-quantitative RT-PCR amplification to assess the relative abundance of this isoform. Here we utilized ribonuclease protection to quantify CaV2.2e[37a] mRNA levels in adult DRG and adult brain. Our representative images show fully protected and partially protected e37a-containing probes hybridized to RNA from both tissue sources (Fig. 1D). CaV2.2e[37a] mRNAs are present in brain at measurable levels; however, we found that CaV2.2e[37a] levels are 
3-fold higher in DRG than in brain. In DRG, CaV2.2e[37a] transcripts represent 6% of all CaV2.2 RNA, compared to 2% in brain. Based on our previous analyses, 35% of neurons in DRG express e37a and of these 75% are small diameter nociceptors (Bell et al. 2004).
Different size currents in tsA201 cells
We compared calcium currents recorded from tsA201 cells transiently expressing CaV2.2e[37a] and CaV2.2e[37b] along with CaVß3 and CaV21 subunits. Average current densities (pA pF–1) were consistently and significantly larger in cells expressing CaV2.2e[37a] than in cells expressing CaV2.2e[37b] (Fig. 2A and B). These data confirm and extend our previous analyses using the Xenopus oocyte expression system. Peak inward CaV2.2e[37a] current densities were 2.8- to 1.3-fold greater than those of CaV2.2e[37b], depending on test potential (Fig. 2C). Our data strongly implicate sequences encoded by e37a and e37b in regulating macroscopic N-type current amplitude. Further, our collective results show that the presence of e37a is necessary and sufficient to support larger whole cell N-type currents in three different cell types: neurons (Bell et al. 2004), Xenopus oocytes (Bell et al. 2004) and mammalian tsA201 cells (Fig. 2) This suggests that alternative splicing influences a mechanism common to three different cell types.
|
We analysed activation curves generated from tail currents and confirmed that CaV2.2e[37a] channels activated at voltages that were slightly but significantly more hyperpolarized as compared to CaV2.2e[37b] channels (Fig. 3). CaV2.2e[37a] and CaV2.2e[37b] activation curves deviated significantly at test voltages that corresponded to the largest difference in current densities (cf. Figs 2C and 3). This shift in activation suggests that CaV2.2e[37a] channels have a greater channel open probability at negative voltages. At positive voltages where the difference in current density between isoforms is the smallest, channel open probabilities converge and approach maximum (Fig. 3). For the N-type channel, maximum channel open probability is close to 0.9 (Lee & Elmslie, 1999).
|
Our analyses suggest that CaV2.2e[37a] channels might remain open for longer than CaV2.2e[37b] channels (Fig. 3). We tested this hypothesis by two independent measures. First, we compared deactivation kinetics of whole-cell tail currents from CaV2.2e[37a] and CaV2.2e[37b] channels. If assessed at voltages subthreshold for channel activation, the deactivation time constant is a measure of average single-channel activation duration. We compared deactivation kinetics of CaV2.2e[37a] and CaV2.2e[37b] currents at –60 mV and found that CaV2.2e[37a] currents deactivated 1.5-fold more slowly than CaV2.2e[37b] currents (P < 0.05; Fig. 4A), suggesting that CaV2.2e[37a] channels remain open for longer on average than CaV2.2e[37b] channels.
|
2 subunits (Wakamori et al. 1999). Single-channel conductances of CaV2.2e[37a] and CaV2.2e[37b] isoforms were indistinguishable (21 pS, Fig. 5). This is consistent with fact that the isoforms differ only in their C-termini and that their pore sequences are identical (CaV2.2e[37a], AY211500; CaV2.2e[37b], AF055477).
|
1.4-fold longer (P < 0.05) as compared to CaV2.2e[37b] channels. This is consistent with our analyses of whole-cell current deactivation kinetics.
|
CaV2.2e[37a] channels express at higher density
The difference in gating kinetics between CaV2.2e[37a] and CaV2.2e[37b] channels contributes to setting overall current density particularly at more hyperpolarized voltages, but this alone is insufficient to account for the larger current densities of CaV2.2e[37a] currents (Bell et al. 2004). We therefore compared gating currents between isoforms to test the hypothesis that CaV2.2e[37a]-expressing cells have more functional channels on their surface than those cells expressing CaV2.2e[37b]. Gating currents originate from the displacement of gating charges within the protein and total charge moved during the gating current therefore reflects the total number of functional channels on the cell surface (Bezanilla, 2000). Gating currents precede pore opening and, consequently, initiation of the ionic current. However, gating and ionic currents are not perfectly separated in time. To resolve gating current in the absence of ionic current, we measured currents generated by the isoforms at the ionic reversal potential where the net flow of ions through the pore is zero (Lin et al. 2004). We determined the ionic reversal potential for each cell and evoked gating current by a test pulse to the ionic reversal potential (Fig. 7A).This method allowed us to calculate the total gating charge transferred for each cell expressing CaV2.2 isoforms with recording solutions identical to those used to measure ionic currents (Fig. 2). We first showed that kinetics and voltage-dependence of gating currents measured from both isoforms were not significantly different (Fig. 7; P > 0.4). Gating current decay time constants were 0.502 ± 0.009 ms (n
= 18) and 0.527 ± 0.011 ms (n
= 16) and Boltzmann slope factors were 8.81 ± 0.80 mV (n
= 18) and 8.47 ± 0.37 mV (n
= 16) for CaV2.2e[37a] and CaV2.2e[37b], respectively (Fig. 7). By contrast, alternative splicing in a different domain of CaV2.2, (ISVS3-IVS4) close to the domain IV voltage sensor, significantly modifies N-type channel gating current kinetics (Lin et al. 2004). Although the basic properties of gating currents did not differ between isoforms, the average gating charge in cells expressing CaV2.2e[37a] was significantly greater (22.5 ± 2.6 fC pF–1; n
= 18) than that in cells expressing CaV2.2e[37b] (15.4 ± 1.5 fC pF–1; n
= 16, Fig. 7B; P < 0.05). Notably, this 1.5-fold difference in the size of the gating charge between isoforms parallels the difference in N-type current densities measured at a similar voltage, close to the reversal potential (1.3-fold; Fig. 2C).
|
Maximal channel open probabilities are indistinguishable
We also compared maximal gating charge displaced (Qmax) with the whole-cell conductance (Gmax) for each cell, as described by Agler et al. (2005). This allowed us to compare channel open probabilities of isoforms at positive voltages where single-channel currents are difficult to resolve. Based on our comparison of isoform activation curves and studies of native N-type currents by others (Lee & Elmslie, 1999), we expected little difference in channel open probabilities between isoforms at strongly positive voltages because activation approached maximum (Fig. 3B). Gmax was determined from each cell as the slope of the peak current-voltage relationship (between +20 and +60 mV, Fig 2B). Gmax is related to single channel open probability at maximal depolarization by the following equation:
|
| (1) |
is the single-channel conductance. Qmax can be determined according to the following equation:
|
| (2) |
/qmax) (Fig. 8). We have shown that splicing of e37a and e37b does not alter single-channel conductance (Fig. 5). We can also assume that the number of elementary charges moved by CaV2.2e[37a] and CaV2.2e[37b] channels are the same because the kinetics and voltage dependencies of their gating currents are indistinguishable (Fig. 7B and C), as expected for channels whose core sequences are identical. In this case, Gmax/Qmax is proportional to POmax.
|
Greater calcium entry induced by action potential waveforms in cells expressing CaV2.2e[37a]
Our data support the hypothesis that e37a increases the number of functional N-type calcium channels expressed on the cell surface as compared to e37b, and that e37a also influences channel open probability particularly at test potentials during the initial and steep phases of the activation curve. An important prediction from our studies is that CaV2.2e[37a] channels will support more calcium entry in response to physiologically relevant stimuli, including action potentials. We do not have tools such as isoform-specific toxins to test this hypothesis directly in neurons; however, we can measure the relative efficacy of CaV2.2e[37a] and CaV2.2e[37b] channels to support calcium entry in response to action potential waveforms using the tsA201 expression system (Scroggs & Fox, 1992; Park & Dunlap, 1998; Blair & Bean, 2003; Thaler et al. 2004). Of particular relevance are action potentials recorded from nociceptors that express a combination of CaV2.2e[37a] and CaV2.2e[37b] isoforms. Single DRG action potentials evoked by brief current injections and a train of action potential evoked by exposure to 500 nM capsaicin were provided by Bruce P. Bean and colleagues (Blair & Bean, 2003) and used as command voltages to induce currents in cells expressing the two isoforms. These action potentials had characteristic plateaux or shoulders typical of small diameter nociceptors (Scroggs & Fox, 1992; Park & Dunlap, 1998). We integrated total current evoked by individual action potentials (Figs 9A–C and 10A and B) as well as a train of action potentials induced by exposure to 500 nM capsaicin (Fig. 9D). In all cases, the averaged total integrated calcium current was significantly larger in cells expressing CaV2.2e[37a] channels than in cells expressing CaV2.2e[37b] channels. In Fig. 9, we show examples of current traces and averaged data from experiments using action potential recordings obtained from four different nociceptors of DRG (Fig. 9A–D). In Fig. 10 we show similar recordings using spontaneous action potentials obtained from a dopaminergic neuron of the substantia nigra (Fig. 10A) and an evoked action potential from a CA1 hippocampal neuron (Fig. 10B). Collectively, these experiments support the hypothesis that CaV2.2e[37a] channels are more efficient than CaV2.2e[37b] channels in coupling action potential depolarization to calcium entry.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Functional significance
We have shown that CaV2.2e[37a] represents only 6% of total CaV2.2 mRNA in whole DRG; however, the relative abundance of CaV2.2e[37a] must be substantially higher in individual nociceptive neurons. Two observations suggest that CaV2.2e[37a] and CaV2.2e[37b] mRNAs are, on average, present at approximately equal abundance in nociceptors that express both. First, CaV2.2e[37a] was found in 35% of DRG neurons. Of these neurons, 75% were small diameter nociceptors that should contribute significantly less RNA to the total pool than large diameter neurons. Thus, CaV2.2e[37a] levels are at least 20% of total CaV2.2 RNA in individual neurons. This is probably closer to 40%, as large diameter neurons probably contribute 2-fold more RNA than nociceptors (based on a 1.5-fold difference in cell capacitance between these two populations; Bell et al. 2004). Second, we showed previously that peak N-type currents in nociceptors expressing both e37a and e37b isoforms were 1.5-fold larger than currents in nociceptors expressing CaV2.2e[37b] alone (Bell et al. 2004). When expressed separately as pure populations of channels, CaV2.2e[37a] supports N-type currents that are 2.5-fold larger at their peak (Fig. 2B). Considering differences between peak currents, we predict that CaV2.2e[37a] and CaV2.2e[37b] mRNAs are equally abundant in nociceptive neurons. Our ribonuclease protection analyses also allowed us to measure CaV2.2e[37a] mRNA levels accurately in brain. Although present at low levels, CaV2.2e[37a] mRNA was detected in brain, implying that CaV2.2e[37a] isoforms might be restricted to specific subsets of neurons in the central nervous system. Additional tools, such as isoform-specific antibodies, would enable us to determine the expression pattern of these CaV2.2 isoforms.
The impact on N-type current density mediated by alternative splicing at the e37a/e37b locus is substantial, ranging from 2.5-fold larger currents in tsA201 cells expressing CaV2.2e[37a] compared to CaV2.2e[37b] at voltages between –10 and 0 mV to 1.3-fold larger currents at strongly positive voltages (Fig. 2C). Our studies of cloned channels are generally consistent with our previous analyses of native N-type currents in nociceptors that revealed a strong correlation between the expression of CaV2.2e[37a] mRNA and larger N-type current densities. However, by comparing the properties of CaV2.2 splice variants isolated from other calcium currents, we also find that CaV2.2e[37a] channels activate at voltages more hyperpolarized and remain open for longer than CaV2.2e[37b] channels. The following observations support this conclusion: (i) activation thresholds for CaV2.2e[37a] channels are more hyperpolarized in tsA201 cells (Fig. 3) and in Xenopus oocytes (Bell et al. 2004); (ii) CaV2.2e[37a] channels deactivate more slowly at –60 mV, consistent with longer open times (Fig. 4A); (iii) single CaV2.2e[37a] channels remain open for longer, on average, than CaV2.2e[37b] channels (Fig. 6); and (iv) macroscopic CaV2.2e[37a] currents inactivate more slowly in response to long duration test pulses (Fig. 4B). We did not observe differences in N-type channel gating between neurons expressing CaV2.2e[37b] alone and those expressing both isoforms (Bell et al. 2004). However, as discussed previously (Bell et al. 2004), small differences in activation thresholds of whole-cell currents in neurons may be masked by a combination of the toxin-subtraction method needed to isolate the N-type currents and the influence of other splice isoforms of CaV2.2 with their own distinct properties (see Lipscombe & Castiglioni, 2004). We also note the relatively high error associated with N-type current densities measured from nociceptors at more positive voltages (Figure 7 of Bell et al. 2004). These factors complicate quantitative comparisons between native currents and heterologously expressed cloned channels particularly at test voltages either side of peak current.
Nonetheless, all our analyses demonstrate that e37a increases N-type current density. N-type channels are targets of numerous signalling pathways, the vast majority of which inhibit N-type channel activity via G-protein activation (Ikeda & Dunlap, 1999); G-protein-dependent mechanisms attenuate N-type currents by at most 50% (Ikeda & Dunlap, 1999; Elmslie, 2003). Here, we describe a post-transcriptional mechanism for effecting long-term enhancement of overall N-type current activity and potentially enhancing transmitter release in select cells. Utilizing action potentials recorded from nociceptors, a central dopaminergic neuron and a CA1 hippocampal neuron as the stimulus, we confirm that significantly more calcium enters cells expressing CaV2.2e[37a] than those expressing CaV2.2e[37b]. The use of action potentials recorded from nociceptors with characteristic wide repolarization shoulders is especially relevant because CaV2.2e[37a] channels are enriched in nociceptors. High voltage-activated calcium currents, in turn, are a major component of the repolarization shoulder in action potentials of nociceptors (Blair & Bean, 2002). It would therefore be interesting to determine whether CaV2.2e[37a] isoforms also influence action potential width in nociceptors.
It will also be important to determine whether CaV2.2e[37a] channels are targeted to the nerve terminal. Our previous analyses of N-type currents in nociceptors were restricted to currents measured in cell bodies. The availability of CaV2.2 isoform-specific antibodies would greatly facilitate efforts to determine the subcellular distribution of CaV2.2e[37a] and CaV2.2e[37b] channels.
Alternative splicing influences CaV2.2 channel density
Our data support the hypothesis that e37a facilitates surface expression of functional CaV2.2 channels to a greater extent than e37b. We demonstrated this by comparing gating currents in cells expressing CaV2.2e[37a] and CaV2.2e[37b] (Lin et al. 2004). We used identical recording solutions to measure both ionic currents and gating currents in the same cells (Lin et al. 2004; Agler et al. 2005; McDonough et al. 2005). This allowed direct comparisons between gating and ionic currents, though it is important to emphasize here that gating currents only provide information about functional channels and do not measure channel surface density directly. Whereas ours is the first report to demonstrate that alternative splicing controls expression levels of voltage-gated calcium channels, others have shown that this process regulates expression of postsynaptic receptors. A specific splice variant of synapse-associated protein-97 (SAP-97) targets AMPA receptors to cortical spines (Rumbaugh et al. 2003). In spinal cord, expression of a specific splice isoform of gephyrin, a glycine receptor–tubulin-bridging molecule, sets the level of glycine receptors at inhibitory synapses (Meier & Grantyn, 2004). Alternative splicing of the NMDA receptor modifies synaptic strength with changes in neuronal activity (Mu et al. 2003). Here, alternative splicing of the C2/C2' domain of the NMDA receptor retains the receptor in the endoplasmic reticulum during periods of increased neuronal activity (C2 variants) and promotes its export from the endoplasmic reticulum (C2' variants) when activity is inhibited. It would be interesting to know whether changes in neuronal activity in nociceptive neurons during either normal or disease states regulates splicing of e37a/e37b and subsequent expression of N-type channels. For example, there is evidence that N-type channel activity is up-regulated following peripheral nerve injury in animal models of chronic pain (Matthews & Dickenson, 2001).
The C-terminus of CaV2.2 modulates channel properties
Numerous physiologically important factors are known to influence calcium channel gating kinetics. These include protein binding, phosphorylation and alternative splicing and they involve several different regions of the CaV1 subunit including the I–II and II–III loops, C-terminus and S3–S4 extracellular linkers (Lin et al. 1999; Lee & Elmslie, 2000; Colecraft et al. 2001; Lipscombe, 2004; Thaler et al. 2004). An analogous e37a/e37b splice site is present in the CaV2.1 gene suggesting that this region is an important control site for regulating voltage-gated calcium channel activity. It is interesting that the sequences encoded by these exons, their effects on channel function, and their expression patterns are distinct from CaV2.2 (Soong et al. 2002; Chaudhuri et al. 2004, 2005).
The biosynthetic pathways that direct ion channel targeting to and removal from the plasma membrane are also under tight cellular control (Ma & Jan, 2002). Specific amino acids in the C-terminus of CaV2.2 unique to e37a must regulate channel density either by increasing plasma membrane targeting efficiency or inhibiting channel internalization. Studies of CaV2.2 and other CaV channels implicate the II–III loop and C-terminus in channel targeting (Sakurai et al. 1996; Maximov & Bezprozvanny, 2002; Timmermann et al. 2002). Trafficking of CaV1 to the plasma membrane is stimulated by CaVß subunits that bind to the I–II intracellular loop and displace CaV1 from the endoplasmic reticulum (Bichet et al. 2000). By contrast, the C-terminus has been implicated recently in G-protein-coupled receptor-dependent internalization of CaV2.2 channels in sensory neurons of DRG (Altier et al. 2006). Opioid receptor-like agonists as well as GABAB receptor agonists stimulate CaV2.2 channel removal from the cell surface via distinct mechanisms that both depend on G-protein activation (Altier et al. 2006; Tombler et al. 2006; Lipscombe & Raingo, 2006). These recent studies show that CaV2.2 channel internalization is tightly regulated in sensory neurons, raising the possibility that sequences in the C-terminus encoded by e37a might inhibit this process. Whatever cellular factors target this splice site in the C-terminus, they are likely to be part of the general cellular mechanism for controlling surface expression of CaV2.2 channels as e37a-containing channels generate larger N-type currents in three very different types of cells.
Conclusion
Cell-specific inclusion of e37a in the C-terminus of CaV2.2 channels represents a mechanism for long-term control of N-type calcium channel activity. The region of the C-terminus encoded by e37a/e37b is multifunctional, with synergistic effects on CaV2.2 gating kinetics and surface expression levels that combine to regulate the coupling between action potential stimuli and calcium entry. Although alternative splicing is a common feature of important neural genes, few studies have identified the functional consequences of this process in identified neuronal populations. Our studies emphasize the presence of e37a-containing CaV2.2 mRNA in a subpopulation of sensory neurons; however, we also see significant levels of CaV2.2e[37a] mRNA in brain. This raises the possibility that alternative splicing of e37a/e37b may regulate CaV2.2 channel activity similarly in other localized regions of the nervous system.
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Altier C, Khosravani H, Evans RM, Hameed S, Peloquin JB, Vartian BA et al. (2006). ORL1 receptor-mediated internalization of N-type calcium channels. Nat Neurosci 9, 31–40.[CrossRef][Medline]
Altier C & Zamponi GW (2004). Targeting Ca2+ channels to treat pain: T-type versus N-type. Trends Pharmacol Sci 25, 465–470.[CrossRef][Medline]
Bell TJ, Thaler C, Castiglioni AJ, Helton TD & Lipscombe D (2004). Cell-specific alternative splicing increases calcium channel current density in the pain pathway. Neuron 41, 127–138.[CrossRef][Medline]
Bezanilla
F (2000). The voltage sensor in voltage-dependent ion channels. Physiol Rev
80, 555–592.
Bichet D, Cornet V, Geib S, Carlier E, Volsen S, Hoshi T, Mori Y & De Waard M (2000). The I–II loop of the Ca2+ channel alpha1 subunit contains an endoplasmic reticulum retention signal antagonized by the beta subunit. Neuron 25, 177–190.[CrossRef][Medline]
Blair
NT
&
Bean
BP (2002). Roles of tetrodotoxin (TTX)-sensitive Na+ current, TTX-resistant Na+ current, and Ca2+ current in the action potentials of nociceptive sensory neurons. J Neurosci
22, 10277–10290.
Blair
NT
&
Bean
BP (2003). Role of tetrodotoxin-resistant Na+ current slow inactivation in adaptation of action potential firing in small-diameter dorsal root ganglion neurons. J Neurosci
23, 10338–10350.
Bowersox
SS, Gadbois
T, Singh
T, Pettus
M, Wang
YX
&
Luther
RR (1996). Selective N-type neuronal voltage-sensitive calcium channel blocker, SNX-111, produces spinal antinociception in rat models of acute, persistent and neuropathic pain. J Pharmacol Exp Ther
279, 1243–1249.
Brose WG, Gutlove DP, Luther RR, Bowersox SS & McGuire D (1997). Use of intrathecal SNX-111, a novel, N-type, voltage-sensitive, calcium channel blocker, in the management of intractable brachial plexus avulsion pain. Clin J Pain 13, 256–259.[CrossRef][Medline]
Chaplan
SR, Pogrel
JW
&
Yaksh
TL (1994). Role of voltage-dependent calcium channel subtypes in experimental tactile allodynia. J Pharmacol Exp Ther
269, 1117–1123.
Chaudhuri
D, Alseikhan
BA, Chang
SY, Soong
TW
&
Yue
DT (2005). Developmental activation of calmodulin-dependent facilitation of cerebellar P-type Ca2+ current. J Neurosci
25, 8282–8294.
Chaudhuri
D, Chang
SY, DeMaria
CD, Alvania
RS, Soong
TW
&
Yue
DT (2004). Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels. J Neurosci
24, 6334–6342.
Colecraft
HM, Brody
DL
&
Yue
DT (2001). G-protein inhibition of N- and P/Q-type calcium channels: distinctive elementary mechanisms and their functional impact. J Neurosci
21, 1137–1147.
Colquhoun D & Sigworth F (1983). Fitting and statistical analysis of single-channel records. In Single-Channel Recording, ed. Sakmann B & Neher E, chap 11, pp. 191. Plenum Press, New York.
Cox B (2000). Calcium channel blockers and pain therapy. Curr Rev Pain 4, 488–498.[Medline]
Dredge BK, Polydorides AD & Darnell RB (2001). The splice of life: alternative splicing and neurological disease. Nat Rev Neurosci 2, 43–50.[CrossRef][Medline]
Elmslie
KS (1997). Identification of the single channels that underlie the N-type and L-type calcium currents in bullfrog sympathetic neurons. J Neurosci
17, 2658–2668.
Elmslie KS (2003). Neurotransmitter modulation of neuronal calcium channels. J Bioenerg Biomembr 35, 477–489.[CrossRef][Medline]
Elmslie KS, Kammermeier PJ & Jones SW (1994). Reevaluation of Ca2+ channel types and their modulation in bullfrog sympathetic neurons. Neuron 13, 217–228.[CrossRef][Medline]
Frankenhaeuser
B
&
Hodgkin
AL (1957). The action of calcium on the electrical properties of squid axons. J Physiol
137, 218–244.
Hatakeyama S, Wakamori M, Ino M, Miyamoto N, Takahashi E, Yoshinaga T et al. (2001). Differential nociceptive responses in mice lacking the alpha1B subunit of N-type Ca2+ channels. Neuroreport 12, 2423–2427.[CrossRef][Medline]
Holz GGT, Dunlap K & Kream RM (1988). Characterization of the electrically evoked release of substance P from dorsal root ganglion neurons: methods and dihydropyridine sensitivity. J Neurosci 8, 463–471.[Abstract]
Ikeda SR & Dunlap K (1999). Voltage-dependent modulation of N-type calcium channels: role of G protein subunits. Adv Second Messenger Phosphoprotein Res 33, 131–151.[Medline]
Ino
M, Yoshinaga
T, Wakamori
M, Miyamoto
N, Takahashi
E, Sonoda
J
et al. (2001). Functional disorders of the sympathetic nervous system in mice lacking the alpha 1B subunit (Cav 2.2) of N-type calcium channels. Proc Natl Acad Sci U S A
98, 5323–5328.
Kanumilli
S, Tringham
EW, Payne
CE, Dupere
JR, Venkateswarlu
K
&
Usowicz
MM (2006). Alternative splicing generates a smaller assortment of CaV2.1 transcripts in cerebellar Purkinje cells than in the cerebellum. Physiol Genomics
24, 86–96.
Kim C, Jun K, Lee T, Kim SS, McEnery MW, Chin H, Kim HL, Park JM, Kim DK, Jung SJ, Kim J & Shin HS (2001). Altered nociceptive response in mice deficient in the alpha(1B) subunit of the voltage-dependent calcium channel. Mol Cell Neurosci 18, 235–245.[CrossRef][Medline]
Krovetz
HS, Helton
TD, Crews
AL
&
Horne
WA (2000). C-terminal alternative splicing changes the gating properties of a human spinal cord calcium channel alpha 1A subunit. J Neurosci
20, 7564–7570.
Lee
HK
&
Elmslie
KS (1999). Gating of single N-type calcium channels recorded from bullfrog sympathetic neurons. J Gen Physiol
113, 111–124.
Lee
HK
&
Elmslie
KS (2000). Reluctant gating of single N-type calcium channels during neurotransmitter-induced inhibition in bullfrog sympathetic neurons. J Neurosci
20, 3115–3128.
Lin
Y, McDonough
SI
&
Lipscombe
D (2004). Alternative splicing in the voltage-sensing region of N-type CaV2.2 channels modulates channel kinetics. J Neurophysiol
92, 2820–2830.
Lin Z, Haus S, Edgerton J & Lipscombe D (1997). Identification of functionally distinct isoforms of the N-type Ca2+ channel in rat sympathetic ganglia and brain. Neuron 18, 153–166.[CrossRef][Medline]
Lin
Z, Lin
Y, Schorge
S, Pan
JQ, Beierlein
M
&
Lipscombe
D (1999). Alternative splicing of a short cassette exon in alpha1B generates functionally distinct N-type calcium channels in central and peripheral neurons. J Neurosci
19, 5322–5331.
Lipscombe D (2005). Neuronal proteins custom designed by alternative splicing. Curr Opin Neurobiol 15, 358–363.[CrossRef][Medline]
Lipscombe D & Castiglioni AJ (2004). Alternative splicing in voltage-gated calcium channels. In Calcium Channel Pharmacology, ed. McDonough SI. Kluwer Academic/Plenum, New York, New York.
Lipscombe D & Raingo J (2006). Internalizing channels: a mechanism to control pain? Nat Neurosci 9, 8–10.[CrossRef][Medline]
Ma D & Jan LY (2002). ER transport signals and trafficking of potassium channels and receptors. Curr Opin Neurobiol 12, 287–292.[CrossRef][Medline]
McDonough
SI, Mori
Y
&
Bean
BP (2005). FPL 64176 modification of Ca(V)1.2, L-type calcium channels: dissociation of effects on ionic current and gating current. Biophys J
88, 211–223.
). B, Whole-cell current–voltage relationships of CaV2.2e[37a] (•, n
= 20) and CaV2.2e[37b] (
deact) are significantly different (P < 0.05) and are 0.40 ± 0.03 ms for CaV2.2e[37a] channels (•, n
= 13) and 0.26 ± 0.05 ms for CaV2.2e[37b] channels (
