|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR |
1 Laboratory of Signal Transduction, National Institute of Environmental Health Sciences, National Institutes of Health, Department of Health and Human Services, Research Triangle Park, NC 27709, USA
| Abstract |
|---|
|
|
|---|
(Received 27 November 2006;
accepted after revision 8 January 2007;
first published online 11 January 2007)
Corresponding author G. S. Bird: NIEHS, PO Box 12233, Research Triangle Park, NC 27709, USA. Email: bird{at}niehs.nih.gov
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
HEK293 cells (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum and 2 mM glutamine and maintained in a humidified 95% air5% CO2 incubator at 37°C. HEK293 cells stably expressing a green fluorescent protein-tagged TRPC3 were also maintained in culture as described by Trebak et al. (2003). In preparation for cDNA transfection or small inhibitory RNA (siRNA) knockdown, cells were transferred to six-well plates and allowed to grow to
90% confluence. In preparation for Ca2+ measurements, cells were cultured to about 70% confluence and then transferred onto 30 mm round glass coverslips (#1 thickness) at two different cell densities (Bird & Putney, 2005). Specifically, 0.5 ml either a 400 000 cells ml1 (high density) or 60 000 cells ml1 (low density) cell suspension was transferred to the centre of the coverslip, and the cells were left to attach for a period of 12 h. Additional DMEM was then added to the coverslip, and the cells were maintained in culture for an additional 36 h before use for calcium measurements. Unless specified, cells were grown in the high density condition; as previously described, low density conditions were required for reproducible responses to arachidonic acid (Bird & Putney, 2005).
Plasmids
Stim1 with the enhanced yellow fluorescent protein (EYFP) fused to the N-terminus was obtained from Tobias Meyer, Stanford University. Full-length Stim2 cDNA plasmid was purchased from Origene in the pCMV6-XL5 vector, and EYFP-C1 from Clontech (Mountain View, CA, USA).
siRNA knockdown
HEK293 cells were plated in a six-well plate on day 1. On day 2, cells were transfected with siRNA (100 nM) against Stim1 (Dharmacon, Lafayette, CO, USA), Orai1 (Invitrogen) or siCONTROL (Dharmacon) using Metafectene (Biontex Laboratories GmbH, Martinsried/Planegg, Germany; 7 µl per well), and including siGLO (Dharmacon) as a marker. The sequence of the siRNA against Stim1 was: agaaggagcuagaaucucac (Mercer et al. 2006); for Orai1 it was: cccuucggccugaucuuuaucgucu (Mercer et al. 2006). After a 6 h incubation period, the medium bathing the cells was replaced by DMEM and maintained in culture. On day 3, siRNA-treated cells were optionally transfected with cDNA for Stim1 tagged with EYFP, Stim2 plus EYFP or EYFP alone as described below. On day 4, cells were transferred to 30 mm glass coverslips in preparation for Ca2+ measurements as described above, which were performed on day 5 or 6.
cDNA transfection
HEK293 cells were plated in a six-well plate on day 1. On day 2, cells were transfected using Lipofectamine 2000 (Invitrogen; 2 µl per well) with cDNA for EYFP, EYFP-tagged Stim1 or EYFP-tagged Stim2. After a 6 h incubation period, the medium bathing the cells was replaced by complete DMEM and maintained in culture. On day 3, cDNA-treated cells were transferred to 30 mm glass coverslips in preparation for Ca2+ measurements as described above, which were performed on day 4 or 5. The concentrations of plasmids used were 0.5 µg well1 for EYFPStim1, 0.1 µg well1 for EYFP and 2 µg well1 for Stim2.
Single-cell calcium measurement
Fluorescence measurements were made with HEK293 cells loaded with the calcium sensitive dye, fura-5F, as previously described (Bird & Putney, 2005). Briefly, cells plated on 30 mm round coverslips and mounted in a Teflon chamber were incubated in DMEM with 1 µM of the acetoxymethyl ester (AM) form of fura-5F (fura-5F/AM, Molecular Probes, USA) at 37°C in the dark for 25 min. For [Ca2+]i measurements, cells were bathed in Hepes-buffered salt solution (HBSS) at room temperature (21°C) containing (mM): NaCl 120, KCl 5.4, Mg2SO4 0.8, Hepes 20, CaCl2 1.8 and glucose 10; pH was adjusted to 7.4 with NaOH. Nominally Ca2+-free solutions were HBSS with no added CaCl2. Fluorescence images of the cells were recorded and analysed with a digital fluorescence imaging system (InCyt Im2, Intracellular Imaging Inc., Cincinnati, OH, USA). Fura-5F fluorescence was monitored by alternatively exciting the dye at 340 and 380 nm, and collecting the emission wavelength at 520 nm. Changes in intracellular calcium are expressed as the ratio of fura-5F fluorescence due to excitation at 340 and 380 nm (F340/F380). Before starting the experiment, regions of interests identifying transfected cells expressing the EYFP tag were created by observing cells at a 530 nm emission wavelength and illuminated with 477 nm excitation light. Typically, 2535 cells were monitored per experiment. In all cases, ratio values have been corrected for contributions by autofluorescence, which is measured after treating cells with 10 µM ionomycin and 20 mM MnCl2. Quantitative analysis of agonist-induced oscillation rates was carried out as previously described (Bird & Putney, 2005). Rates of oscillation were calculated on responding cells only, and the fraction of responding cells is reported in each case. Responding cells were those producing at least one immediate transient rise in [Ca2+]i following application of methacholine.
Calcium entry RNAi screen
By monitoring agonist- and thapsigargin-induced CCE in HEK293 cells, an RNAi screen was performed using SMARTpool siRNA reagents (Dharmacon). The screen involved transfection with SMARTpool siRNA, a mixture of four siRNAs designed and synthesized by the vendor. In preparation for siRNA knockdown, HEK293 cells were plated in a 96-well plate (at 10 000 cells per well) (day 1). On day 2, cells were transfected with various siRNAs using metafectene, and including siGLO (Dharmacon) as a marker. After 6 h incubation, the medium bathing the cells was replaced by complete DMEM. Transfected cells were maintained in culture until day 4 when [Ca2+]i measurements were performed.
The effects of siRNA on Ca2+ entry were screened using cells seeded in 96-well plates and a fluorescence imaging plate reader (FLIPR384, Molecular Devices, CA, USA). Agonist- and thapsigargin-induced [Ca2+]i changes were measured in transfected HEK293 cells grown on a 96-well plate and loaded with a calcium-sensitive no wash dye (FLIPR Calcium 3 Assay kit, Molecular Devices Corp., Sunnyvale, CA, USA). Fluorescence was monitored on a fluorescence imaging plate reader, FLIPR384, by exciting the calcium indicator at 488 nm, and collecting emission fluorescence at 510570 nm.
Materials
Methacholine was purchased from Sigma (St Louis, MO, USA), thapsigargin from Alexis (San Diego, CA, USA), fura-5F/AM from Molecular Probes (Eugene, OR, USA) and arachidonic acid, (5,8,11,14-eicosatetraenoic acid) was obtained from BioMol (PA, USA). SMARTpool combinations of four siRNAs against Stim1, Stim2 and 34 TRP genes, as well as a control siRNA (siCONTROL) and fluorescent siRNA (siGLO) were obtained from Dharmacon.
| Results and Discussion |
|---|
|
|
|---|
|
|
|
Thus far, we have confirmed findings from other laboratories that knocking down the levels of Stim1 in HEK293 cells substantially reduces the calcium entry signal activated under maximal stimulus conditions with thapsigargin, and by use of a rescue protocol, demonstrated that the effects of the specific siRNA duplex we have employed are specific for effects on Stim1 expression. However, the relevance of findings with complete Ca2+ store depletion by thapsigargin to signalling mechanisms with agonists at physiological stimulation strengths has been rightly questioned (Shuttleworth, 1999; van Rossum et al. 2004). Thus, we next wanted to use these same molecular approaches to investigate the Ca2+ entry pathway underlying a more physiologically relevant [Ca2+]i response (i.e. agonist-induced [Ca2+]i oscillations).
In experiments summarized in Fig. 4, we have characterized the effect of Stim1 siRNA on methacholine-induced calcium oscillations in HEK293 cells. As previously reported (Bird & Putney, 2005), treatment of fura-5F-loaded HEK293 cells with 5 µM methacholine in the presence of 1.8 mM extracellular Ca2+ results in a sustained, or slowly declining oscillatory Ca2+ response in the majority of cells (Fig. 4A). As previously described (Bird & Putney, 2005), the characteristics of this Ca2+ response to 5 µM methacholine are that
80% of the cells respond (Fig. 4D) and with an oscillatory response that is sustained over the 25 min period tested (Fig. 4E). By contrast, the oscillations in HEK293 cells treated with Stim1 siRNA in response to 5 µM methacholine were not sustained but transient (Fig. 4B and E). This would be consistent with the loss of a calcium entry required to support oscillations. However, as indicated in Fig. 4D, the percentage of responding cells under these conditions falls to
45%. These two characteristics, reduced responsiveness and transient oscillatory frequency, bare the hallmarks of an agonist response observed with a lower agonist concentration (see data for response to 1 µM methacholine by Bird & Putney (2005)).
|
The above findings are consistent with a primary effect of Stim1 knockdown on loss of calcium entry necessary for sustained oscillations. To further evaluate this interpretation, we investigated the effects of Gd3+ insulation on the oscillatory calcium response in Stim1 knockdown cells. That is, we incubated HEK293 cells in the presence of a high concentration of GdCl3 (1 mM), such that transmembrane calcium fluxes across the plasma membrane in both directions were prevented. Under these conditions, HEK293 cells do not lose intracellular calcium to the extracellular space, and agonist-induced [Ca2+]i oscillations are sustained despite the absence of calcium entry (Sneyd et al. 2004; Bird & Putney, 2005). As shown in Fig. 5A, the transient oscillatory calcium response observed with 10 µM methacholine in Stim1 siRNA-treated cells is now sustained in the presence of 1 mM GdCl3. Thus, the primary effect of Stim1 knockdown on agonist-induced [Ca2+]i oscillations is to cause loss of the calcium entry necessary to sustain them. As a final proof of this idea, we transiently expressed Stim1 in these same Stim1 siRNA-treated cells with the result that the sustained oscillatory calcium response to methacholine was now rescued (Fig. 5B).
|
|
Effects of knockdown of Orai1 and TRP channels
In addition to Stim1, capacitative or store-operated Ca2+ entry depends upon a plasma membrane protein, Orai1 (Feske et al. 2006; Zhang et al. 2006; Vig et al. 2006b). Recent findings indicate that Orai1 probably functions as a subunit of the store-operated channel itself (Yeromin et al. 2006; Prakriya et al. 2006; Vig et al. 2006a). As shown in Fig. 7, knockdown of Orai1 by RNAi (Mercer et al. 2006) significantly reduced the frequency of [Ca2+]i oscillations without reducing the percentage of cells responding to methacholine (Fig. 7A and B). This effect was due to reduction of Ca2+ entry because the inhibition resulting from knockdown of Orai1 was prevented by use of 1 mM Gd3+ to prevent both Ca2+ entry and Ca2+ extrusion (Fig. 7C). Finally, similar to the findings for Stim1, knockdown of Orai1 by RNAi did not affect arachidonic acid-induced Ca2+ entry (Fig. 6C).
|
|
|
Together, our data confirm recent studies implicating Stim1, a Ca2+-binding protein located in the membrane of the endoplasmic reticulum, as a potential Ca2+ sensor that initiates the process of store-operated Ca2+ entry. In contrast with the findings of Liou et al. (2005) and consistent with the findings of Roos et al. (2005), we found no evidence of such a role for Stim2; knockdown of Stim2 had no effect on Ca2+ signalling in HEK293 cells and, more significantly, Stim2 could not rescue [Ca2+]i responses after knockdown of Stim1. We have provided the first demonstration of an essential role for Stim1 and also Orai1 in the mechanism of [Ca2+]i signalling with physiological stimulus strength, when [Ca2+]i levels undergo oscillations. We have also demonstrated for the first time that TRPC3 channels and arachidonic acid-activated channels, both of which are activated downstream of phospholipase C, but not by Ca2+-store depletion, do not require Stim1.
While this work was under review, a publication appeared by Mignen et al. (2007) proposing a role for Stim1 in arachidonic acid-activated current in HEK293 cells. In contrast to the findings reported here, these authors reported suppression of arachidonate-activated currents by knockdown of Stim1. The reason for these discrepant results is not clear. However, interestingly, Mignen et al. (2007) also reported that it was specifically Stim1 in the plasma membrane that supported the arachidonate-activated currents. In our experiments in which we rescued [Ca2+]i oscillations following Stim1 knockdown, we utilized an EYFPStim1 construct which we (Mercer et al. 2006) and others (Liou et al. 2005) have shown does not traffic to the plasma membrane. Thus, it is unlikely that the role of Stim1 shown in our current study involves regulation of arachidonic acid-activated currents.
The current findings extend and support our previous conclusions on the nature of the Ca2+ entry mechanism that supports [Ca2+]i oscillations in this model system. Previously, we reported that it was predominantly if not exclusively the store-operated pathway that supported [Ca2+]i oscillations. That argument was based primarily on pharmacological properties of the store-operated pathway. Here we utilized a molecular criterion the requirement for Stim1 and Orai1 to further support this conclusion. The conclusion drawn by Yan et al. (2006) regarding the lack of a role for store-operated entry in C. elegans intestinal cell oscillations may be specific for that particular cell type, and at present should probably not be assumed to be a general property. The current study supports our previous conclusion (Bird & Putney, 2005) that [Ca2+]i oscillations are dependent on store-operated channels in the HEK293 cell model, but our results with TRPC3 over-expressing cells show that [Ca2+]i oscillations can be supported by non-store-operated channel mechanisms. Thus, we believe it is important to consider the question of the nature of regulated Ca2+ entry responsible for [Ca2+]i oscillations or other important response patterns independently for each particular cell type, receptor type or physiological process. The advent of molecular players in the store-operated pathway provides powerful tools for such investigations. With these and other tools, we can continue to probe the molecular and cellular processes that integrate plasma membrane Ca2+ fluxes with the complex [Ca2+]i oscillations.
| References |
|---|
|
|
|---|
Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, Hogan PG, Lewis RS, Daly M & Rao A (2006). A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 441, 179185.
Huang GN, Zeng W, Kim JY, Yuan JP, Han L, Muallem S & Worley PF (2006). STIM1 carboxyl-terminus activates native SOC, Icrac and TRPC1 channels. Nat Cell Biol 8, 10031010.[CrossRef][Medline]
Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE Jr & Meyer T (2005). STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol 15, 12351241.[CrossRef][Medline]
Lopez J, Salido GM, Pariente JA & Rosado JA (2006). Interaction of STIM1 with endogenously expressed human canonical TRP1 upon depletion of intracellular Ca2+ stores. J Biol Chem 281, 2825428264.
Luo D, Broad LM, Bird GS & Putney JW Jr (2001a). Signaling pathways underlying muscarinic receptor-induced [Ca2+]i oscillations in HEK293 cells. J Biol Chem 276, 56135621.
Luo D, Broad LM, Bird GS & Putney JW Jr (2001b). Mutual antagonism of calcium entry by capacitative and arachidonic acid-mediated calcium entry pathways. J Biol Chem 276, 2018620189.
Mercer JC, DeHaven WI, Smyth JT, Wedel B, Boyles RR, Bird GS & Putney JW Jr (2006). Large store-operated calcium-selected currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J Biol Chem 281, 2497924990.
Mignen O, Thompson JL & Shuttleworth TJ (2007). Stim1 regulates Ca2+ entry via arachidonate-regulated Ca2+-selective (ARC) channels without store-depletion or translocation to the plasma membrane. J Physiol in press.
Mignen O, Thompson JL, Yule DI & Shuttleworth TJ (2005). Agonist activation of arachidonate-regulated Ca2+-selective (ARC) channels in murine parotid and pancreatic acinar cells. J Physiol 564, 791801.
Parekh AB & Penner R (1997). Store depletion and calcium influx. Physiol Rev 77, 901930.
Parekh AB & Putney JW Jr (2005). Store-operated calcium channels. Physiol Rev 85, 757810.
Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A & Hogan PG (2006). Orai1 is an essential pore subunit of the CRAC channel. Nature 443, 230233.
Putney JW Jr (1986). A model for receptor-regulated calcium entry. Cell Calcium 7, 112.[Medline]
Putney JW Jr (1997). Capacitative Calcium Entry, pp. 1210. Landes Biomedical Publishing, Austin, TX.
Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Velicelebi G & Stauderman KA (2005). STIM1, an essential and conserved component of store-operated Ca2+ channel function. J Cell Biol 169, 435445.
Shuttleworth TJ (1997). Arachidonic acid activates the noncapacitative entry of Ca2+ during [Ca2+]i oscillations. J Biol Chem 271, 2172021725.
Shuttleworth TJ (1999). What drives calcium entry during [Ca2+]i oscillations? challenging the capacitative model. Cell Calcium 25, 237246.[CrossRef][Medline]
Shuttleworth TJ & Thompson JL (1998). Muscarinic receptor activation of arachidonate-mediated Ca2+ entry in HEK293 cells is independent of phospholipase C. J Biol Chem 273, 3263632643.
Shuttleworth TJ, Thompson JL & Mignen O (2004). ARC channels: a novel pathway for receptor-activated calcium entry. Physiology (Bethesda) 19, 355361.[CrossRef][Medline]
Sneyd J, Tsaneva-Atanasova K, Yule DI, Thompson JL & Shuttleworth TJ (2004). Control of calcium oscillations by membrane fluxes. Proc Natl Acad Sci U S A 101, 13921396.
Trebak M, Bird GS, McKay RR, Birnbaumer L & Putney JW Jr (2003). Signaling mechanism for receptor-activated TRPC3 channels. J Biol Chem 278, 1624416252.
van Rossum DB, Patterson RL, Kiselyov K, Boehning D, Barrow RK, Gill DL & Snyder SH (2004). Agonist-induced Ca2+ entry determined by inositol 1,4,5-trisphosphate recognition. Proc Natl Acad Sci U S A 101, 23232327.
Vig M, Beck A, Billingsley JM, Lis A, Parvez S, Peinelt C, Koomoa DL, Soboloff J, Gill DL & Fleig A (2006a). CRACM1 multimers form the ion-selective pore of the CRAC channel. Curr Biol 16, 20732079.[CrossRef][Medline]
Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, Kraft S, Turner H, Fleig A, Penner R & Kinet JP (2006b). CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Science 312, 12201223.
Yan X, Xing J, Lorin-Nebel C, Estevez AY, Nehrke K, Lamitina T & Strange K (2006). Function of a STIM1 homologue in C. elegans: evidence that store-operated Ca2+ entry is not essential for oscillatory Ca2+ signaling and ER Ca2+ homeostasis. J Gen Physiol 128, 443459.
Yeromin AV, Zhang SL, Jiang W, Yu Y, Safrina O & Cahalan MD (2006). Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nature 443, 226229.
Zhang SL, Yeromin AV, Zhang XH, Yu Y, Safrina O, Penna A, Roos J, Stauderman KA & Cahalan MD (2006). Genomewide RNAi screen of Ca2+ influx identifies genes that regulate Ca2+ release-activated Ca2+ channel activity. Proc Natl Acad Sci U S A 103, 93579362.
| Acknowledgements |
|---|
This article has been cited by other articles:
![]() |
I. M. Lorenzo, W. Liedtke, M. J. Sanderson, and M. A. Valverde TRPV4 channel participates in receptor-operated calcium entry and ciliary beat frequency regulation in mouse airway epithelial cells PNAS, August 26, 2008; 105(34): 12611 - 12616. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. I. DeHaven, J. T. Smyth, R. R. Boyles, G. S. Bird, and J. W. Putney Jr. Complex Actions of 2-Aminoethyldiphenyl Borate on Store-operated Calcium Entry J. Biol. Chem., July 11, 2008; 283(28): 19265 - 19273. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Putney and G. S. Bird Cytoplasmic calcium oscillations and store-operated calcium influx J. Physiol., July 1, 2008; 586(13): 3055 - 3059. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Smyth, W. I. DeHaven, G. S. Bird, and J. W. Putney Jr Ca2+-store-dependent and -independent reversal of Stim1 localization and function J. Cell Sci., March 15, 2008; 121(6): 762 - 772. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Varnai, B. Toth, D. J. Toth, L. Hunyady, and T. Balla Visualization and Manipulation of Plasma Membrane-Endoplasmic Reticulum Contact Sites Indicates the Presence of Additional Molecular Components within the STIM1-Orai1 Complex J. Biol. Chem., October 5, 2007; 282(40): 29678 - 29690. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Putney Jr New molecular players in capacitative Ca2+ entry J. Cell Sci., June 15, 2007; 120(12): 1959 - 1965. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gwack, S. Srikanth, S. Feske, F. Cruz-Guilloty, M. Oh-hora, D. S. Neems, P. G. Hogan, and A. Rao Biochemical and Functional Characterization of Orai Proteins J. Biol. Chem., June 1, 2007; 282(22): 16232 - 16243. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |